617

Lời bài hát 遠距離ポスター (Enkyorii Poster) – AKB48

遠距離ポスター (Enkyorii Poster) - AKB48

遠距離ポスター (Enkyorii Poster) - AKB48

Thông tin bài hát

Tên bài hát: 遠距離ポスター (Enkyorii Poster)
Ca sĩ: AKB48
Sáng tác: unknown
Album: Kamikyoku Tachi
Ngày ra mắt: 06/10/2010
Thể loại: Pop / Dance, Nhật Bản

 

Lời bài hát 遠距離ポスター (Enkyorii Poster) – AKB48

BEDDO no migi no kabe
itsudemo kimi ga iru
mizugi no koibito ga
yasashiku hohoemu

[Miy/Tak] kotoba ga nakutatte
[Miy/Tak] genki wo kurerunda
[Miy/Tak] kokoro no taiyou wo
[Miy/Tak] dokusenchuu

[Miy/Nit] AIDORU nante
[Miy/Nit] suki ni naru to
[Miy/Nit] omowanakatta
[Ota/Mae] boku no kimochi wa yosougai
[Ota/Mae] Love you!

enkyori POSUTAA
chikaku ni iru no ni
kimi wa setsunai hodo
te ga todokanai
enkyori renai
shite iru mitai ni
nakanaka aenai kedo
dare yori soba ni iru

toki ni wa shippai shite
choppiri hekonde mo
bonyari nagameru to
me to me ga aunda

dokoka de kimi mo ima
ganbatte iru no darou
boku dake yowane nanka
ienaku naru

[Miy/Nit] chigau sekai
[Miy/Nit] ikiteru kedo
[Ota/Mae] yume ni mukau
[Kas/Miy/Tak] onaji michi wo hashitteru
[Kas/Miy/Tak] Miss you!

enkyori POSUTAA
PURATONIKKU de ii
kimi wo omou tabi
mune ga kurushii yo
enkyori renai
tsudzukanai sa tte
minna ni iwareru kedo
boku nara daijoubu

enkyori POSUTAA
chikaku ni iru no ni
kimi wa setsunai hodo
te ga todokanai
enkyori renai
shite iru mitai ni
nakanaka aenai kedo
dare yori soba ni iru

68 thoughts on “Lời bài hát 遠距離ポスター (Enkyorii Poster) – AKB48

  1. benefits Of using steroids says:

    Myostatin negatively regulates protein synthesis via the
    Akt pathway by inhibiting Akt/p70s6k activation30 and signaling31.
    Myostatin increases protein degradation via activation of the ubiquitin–proteasome system10 and is
    mediated via increased expression of the ubiquitin e3 ligases Atrogin-1 and MuRF-131,
    32,33. Therapies concentrating on the myostatin pathway thus hold promise
    to mitigate muscle atrophy that accompanies disease and disuse34,35.

    When administered to a mouse MD mannequin that exhibited high MSTN mRNA ranges,
    FS extract reduced these ranges in a dose-dependent method (Kim et al., 2015).

    MSTN is translated as a precursor protein, which undergoes several proteolytic processing occasions that end result within the formation of active, mature MSTN (Qian et al., 2015).
    Initially, the amino(N)-terminal sign sequence is eliminated by a sign peptidase to type
    Pro-MSTN, and dimerization follows due to disulfide bond formation close to carboxy(C)-termini.
    Subsequently, furin cleaves the dimer at its proteolytic processing site RXXR site.
    C-terminus cleavage leads to an N-terminal propeptide with an N-linked glycosyl group and a
    receptor-binding domain on the C-terminal.
    Latent MSTN advanced varieties when the N-terminal propeptide binds the C-terminal area noncovalently via a crucial peptide
    sequence, which prevents MSTN from binding to its receptor.

    In the final stage, BMP-1/TLD cleaves the propeptide,
    which outcomes in the release of mature MSTN.
    Two molecules are epimers of each other after they have no less than two uneven carbon atoms however differ by configuration at solely a
    sort of carbons. Primarily, epimers are equivalent molecules with the identical asymmetric carbon atom (and its bonds) rotated in one other way in area (see picture below for reference).
    To get probably the most out of the supplement, Enhanced Athlete recommends taking 1-2 capsules per day with food.

    The pure muscle constructing complement is free from artificial fillers, dyes, chemical
    substances, and deceptive proprietary blends, and
    is made in the United States of America.
    During this session, each participant carried out a follow trial for the Wingate anaerobic cycle
    check to become acquainted with the demands of the check.
    Paul Michael Levesque, higher often recognized as
    Triple H, has dominated the world of WWE for many years.
    Paul Levesque gave us “Connecticut Blueblood,” who later grew to become generally
    recognized as Hunter Hearst Helmsley, shortened as Triple
    H…. This community is designed for individuals excited about DIY biology, typically referred to as biohacking.

    Members can collaborate, share information, and discover topics such as genetic engineering, experimental pharmacology, life extension, longevity, and bio-enhancement.
    This space encourages scientific inquiry and practical
    experimentation in accessible, hands-on methods.
    Following birth, MSTN ranges stay high, although not as elevated as during fetal
    improvement [30]. MSTN-knockout animals, lacking MSTN presence throughout prenatal or neonatal improvement, exhibit a dramatic 2- to
    3-fold increase in muscle mass in comparability with wild-type animals [30].
    Homozygous mutant mice show roughly 30% more physique weight, with each larger muscles fibers in cross-sectional space (hypertrophy) and a greater in fiber quantity (hyperplasia).
    Furthermore, MSTN-knockout animals reveal a higher proportion of kind II fibers and a reduced variety of sort I fibers, together with decreased
    adipose tissue [30–32]. Postnatal suppression of MSTN,
    achieved via conditional gene targeting or the administration of MSTN inhibitors such as its propeptide, antibody,
    or follistatin, induces important however comparatively
    lesser increases in skeletal muscle mass [33–35].
    In distinction to MSTN-knockout models, muscle growth from postnatal suppression of MSTN outcomes solely from muscle hypertrophy,
    not hyperplasia, but still predominantly induces
    type II muscle fibers [36–38].
    Intransgenic mice overexpressing FST exhibit decreased
    quality of skeleton and tibia fractures in contrast to myostatin null mice that display enhanced BMD without fractures (Fig.
    2) [6]. Above all, these findings strongly emphasize the importance of target specificity when growing myostatin inhibitors, especially these supposed for long-term remedy, to minimize potential adverse results in several
    tissues. ACE-011 in a section 1 medical trial conducted on wholesome postmenopausal
    ladies additionally increased hematocrit,
    Hb, and RBC ranges [56]. These results have evoked a substantial curiosity in ACE-011,
    initially developed to deal with bone-loss issues, as a possible therapeutic choice for patients with anemia
    and diseases involving ineffective erythropoiesis.
    Like IL-6, leukemia inhibitory factor (LIF) has also been identified as a myokine,
    released by SM in response to train (Broholm and Pedersen, 2010;
    Pedersen and Febbraio, 2012). Exogenous LIF promotes the proliferation of human myoblast by
    inducing the transcription components JunB and c-Myc (Broholm et al.,
    2011). In addition, LIF has also been found to induce myoblast differentiation (Yang et al., 2009).

    The variety of myostatin-positive SC–myostatin inhibits the progress of SC into the S phase of
    the cell cycle [9]–increased after 2 weeks of immobilization in each
    teams. More studies are needed to determine the connection between disuse-atrophy
    and myostatin-positive SC. Nevertheless, it was consistent with the previous examine reporting the blunted response of the decline in the variety of myostatin-positive SC to resistance train in older adults, who could have an impaired
    myogenic capability in comparability with young [34].

    You see, most roids or anabolics build muscle
    by making the muscle cells you have greater .
    Funding for this examine was offered by a NASA Cooperative
    Agreement NCC8-242 to BioServe House Technologies and in kind contributions of myostatin inhibitor from
    Amgen Inc. Thank you to the Leinwand Laboratory within the Division of Molecular, Cellular and
    Developmental Biology at the University of Colorado at Boulder for help with methods improvement and entry to laboratory assets.
    Due To This Fact, sustaining muscle throughout weight loss is
    critical to sustaining a healthy weight over time. Hence, when performing a therapeutic realignment of the spine and distal joints,
    tight muscular tissues and weak muscle tissue dramatically impression the result
    of therapeutic interventional assist.
    A myostatin inhibitor prevents myostatin from binding to its receptor,
    thereby repressing the downstream Smad-pathway [11]. By supplementing it, you would expertise advantages in muscle
    development and energy and improvements in vascularity,
    blood circulate, and endurance. Coaching with heavy
    weight doubtless provides a feedback stimulus that inhibits myostatin, partially to allow
    for practical muscle growth processes to kick in. If this didn’t happen, we might return to the fitness center
    repeatedly with minimal features to level out for it.
    Coupled with the myostatin inhibition that resistance coaching itself elicits, there could also be
    no room for another inhibitor to work. The study concludes that further tests
    are needed to see whether creatine, leucine and HMB are synergistic with respect
    to myostatin inhibition (and other development pathways) or not.

    The samples have been then centrifuged at 3000 rpm for 10 min at four °C to collect the supernatant.
    The ranges of the neurotransmitters acetylcholine (ACh), glutamate (Glu), gamma-aminobutyric acid
    (GABA), and serotonin (5-HT), that are related
    to fatigue, have been measured utilizing ELISA following the manufacturer’s directions.
    The absorbance at 550 nm and 340 nm was measured
    using a spectrophotometer or microplate reader. The kits
    used in this examine have been evaluated for consistency of
    performance throughout completely different batches of kits by
    recovery checks with recoveries starting from 90%-110%
    and calibrated by standards. The tools used had a measurement accuracy of
    zero.01% and was calibrated earlier than each experiment.
    Ltd. (Wuhan, China), and cultured in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin (Cell-specific
    DMEM; Procell, Wuhan, China) in an incubator at 37 °C with
    5% CO2.
    As beforehand talked about, scientific research of the soluble receptor
    ramatercept were prematurely halted because of vital antagonistic effects,
    similar to nosebleeds, gum bleeding, telangiectasia, and erythema.
    These opposed events have been attributed to the unintended cross-inhibition of BMP9 and BMP10,
    important ligands concerned in endothelial cell perform [12].
    Future research and improvement efforts for MSTN inhibitors ought
    to prioritize specificity to mitigate off-target results and
    enhance efficacy. Two current research, carried out in mouse models of cancer cachexia, have examined the effects of myostatin inhibitors on bodily efficiency and muscle perform, building
    on earlier data that confirmed positive effects on muscle mass [30,31].
    A myostatin antibody in the same mannequin was capable of fully abrogate the tumor-induced reduction in complete muscle force in numerous limb and diaphragm muscles [33▪].
    The outcomes of these current research are
    encouraging as the worth of myostatin inhibitors to cancer patients exhibiting muscle wasting is finally to
    affect functional performance via increased muscle perform.

    For instance, injection of ACVR2B-Fc fusion protein to wild-type mice induced a dramatic enhance (40%-60%) in muscle mass
    in just 2 weeks [37], an impact greater than that
    obtained after treatment with D76A myostatin propeptide or monoclonal anti-myostatin antibody.
    Similarly, administration of ACVR2B-Fc fusion protein to a mouse mannequin of osteogenesis imperfecta
    (OI) caused important will increase in each bone and muscle mass that had been close to those seen in wild-type mice [38].
    Importantly, the soluble ACVR2B receptor exhibited anabolic effects even in myostatin null mice,
    indicating the existence of other TGF-β relations that operate to
    limit muscle growth [37]. After disuse atrophy was induced, the
    decreased muscle CSA and LM of the immobilized leg weren’t recovered inside 2 weeks of returning to normal activity in both teams (Fig 2).
    Related to the interval of immobilization, we could not observe any impact of FOR ingestion on skeletal
    muscle through the recovery part. A earlier examine reported that 2 weeks
    of immobilization was sufficient to induce anabolic resistance–decreased response of
    MPS to anabolic stimuli–in young adults
    [16]. Thus, there’s a risk that the impression of
    FOR was not effective enough to recuperate the loss of
    muscle size with anabolic resistance induced by immobilization or needed an prolonged restoration interval.

    MicroRNAs are a class of small non-coding RNAs that play a significant position in regulating muscle metabolism, development, renewal, and degeneration [114].
    Newest analysis has established that miRNAs play a role within the control of CKD-triggered
    muscle loss by enhancing protein breakdown or hindering myogenesis.
    Muscle loss in the setting of CKD correlates
    with a discount in miR-26a, whereas an elevated degree of miR-26a
    mitigates CKD-triggered muscular atrophy by way of blocking the
    FOXO1 transcription component [31, 115]. A discount in miR-29 ranges leads to the increase of YY1 transcription element function, subsequently
    impeding myogenesis, whereas an elevated level of miR-29 mitigates CKD-triggered wasting of
    muscle tissue via downregulating TGF-β, and YY1 axis proteins [116, 117].

    Myostatin has been shown to be expressed by numerous tumor cell lines in mice and
    man. Unbound has launched with six cutting-edge dietary supplements, manufactured in one of the
    world’s most trusted services at NutraBio HQ. This beast of a supplement makes use of a full medical 750mg yield
    dose of phosphatidic acid, an ingredient we’ve long loved
    — when we can find it.
    Another talked-about method of inhibiting myostatin is through
    the consumption of epicatechin, a member of the flavonoid family
    of chemical substances that management pigmentation in plants [31].
    In both people and animals, myostatin is a
    hormone that acts as a sort of “brake” that tells muscle tissue to stop rising,
    which helps to prevent them from getting too massive. Uneven muscle development is a
    risk should you don’t persist with a regimented coaching and
    recovery schedule. Unchecked muscle development can exhaust tendons and ligaments,
    rising the risk of damage. SwissChems is a trusted name
    within the peptide world, and their Myostatin delivers a potent formula designed to focus on myostatin inhibition instantly.

    Nonetheless, Welle did mention some side effects within the
    mice come the top of the study.
    Moreover, the present research doesn’t back the
    efficacy of myostatin inhibitor supplements for enhancing
    muscle development. If you missed the first article on myostatin and resistance train on Proof Primarily Based Muscle, you can find it right here.
    Briefly, the article mentioned that gentle and
    heavy-weight exercises resulted in similar muscle gene
    responses to exercise, together with myostatin. Myostatin is a category of growth elements genes that
    put the car breaks muscle progress. Myostatin is a
    category of progress differentiation elements that regulate
    muscle progress. Other potential side effects of myostatin inhibitors
    include elevated the possibility of tendon rupture,
    heart failure as a end result of inflamed cardiac muscle, and rhabdomyolysis,
    a breakdown of muscle fibers that often leads to kidney failure [38, 39].

    After the 5 min warm-up period, topics continued to warm-up for an extra
    20 s followed by a 6 s acceleration section, during which they pedaled as fast as possible against no resistance
    to achieve peak cadence. Instantly at the finish of this phase, a load equal to 7.5% of body weight was
    utilized to the flywheel and subjects pedaled as quick as possible for 30 s.

    Information was recorded and saved utilizing the Velotron Wingate software program (Racer-Mate, Seattle, WA).
    The EPI group consumed one capsule containing 100 mg of 98% pure (–)-epicatechin twice every day (200 mg
    total). Individuals had been instructed to eat one one hundred mg capsule in the morning and one 100 mg capsule in the
    afternoon or evening.
    Whole RNA focus was decided spectrophotometrically (SpectraMax 384 Plus and SoftMax Pro
    Software Program, SpectraDrop Micro-Volume Microplate, Molecular Devices, San Jose, CA) by optical density (OD) at 260 nm utilizing
    an OD260 equivalent to 40 μg/μl. Reverse-transcription to synthesize cDNA was performed with a hundred ng of total RNA template
    utilizing the qScript Flex cDNA Equipment following producer’s specifications (Quantabio, Beverly, MA).
    The familiarization session was primarily used to introduce the participants to the train protocol and to the
    exercise and testing instrumentation. The members
    sat on every cycle ergometer to be used for testing and the seat
    was adjusted to the suitable top in order that knee
    flexion was ~20–25 levels at full extension. The participant cycled against no resistance for a brief interval to
    confirm the proper seat top.
    He has this concept as a outcome of when adults have
    experienced will increase in muscle mass due to lower myostatin levels, it’s
    been sarcoplasmic hypertrophy. Primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and myostatin had been commercially synthesized (Integrated DNA Applied Sciences,
    Coralville, IA). The forward primer sequence used for GAPDH
    was ACCACAGTCCATGCCATCAC, and the reverse primer sequence used was
    TCCACCACCCTGTTGCTGTA (21). The ahead primer sequence used
    for myostatin was CTACAACGGAAACAATCATTACCA, and the reverse primer sequence used was GTTTCAGAGATCGGATTCCAGTAT (22).

    It is conceivable the mix of flavonols and phytochemicals present in pure cocoa may have a special effect on skeletal
    muscle adaptation to train. One Other side of (–)-epicatechin supplementation worthy
    of additional research is the timing and duration of supplementation. As A Substitute of persistent supplementation, it might prove beneficial to examine using (–)-epicatechin when supplemented immediately previous to exercise.
    Research have shown (–)-epicatechin will increase blood move through vasodilation by the use of nitric
    oxide production (3). Lastly, the potential inhibition of aerobic diversifications in skeletal muscle as a result of the antioxidant properties of (–)-epicatechin have to be directly examined.

    This disparity in MSTN availability may contribute to
    a shift in efficiency between species. A pharmacokinetic study
    with MYO-029 discovered that the concentration of MYO-029 required
    to elicit a 50% enchancment in muscle mass in monkeys was 18 instances
    higher in comparability with the same improvement in mice [107].

    This discrepancy in pharmacokinetics and MSTN serum concentration between diseased human and mouse fashions might considerably contribute
    to the difference in results between medical and animal trials.
    Inhibiting additional ligands that signal by way of
    the first myostatin receptor could defend in opposition to muscle loss.
    Myostatin is thought to signal by way of transmembrane activin Type IIB receptors (ActRIIB) together with Activin A
    and other ActRIIB ligands28,34.
    Investigations have established that CKD is accompanied by
    mitochondrial impairment, a finding that can be seen within the aged [27].
    Dynamin-related protein 1 (DRP-1) is an indicator of
    mitochondrial fission that sustains mitochondrial regular circumstances.
    Microarray analysis of individuals with CKD, including those undergoing hemodialysis, has indicated a compromised mitochondrial respiratory perform and consequent oxidative injury [28].
    When C2C12 cells reached 70% confluence, growth medium was switched to myogenic differentiation medium
    supplemented with MIF1, MIF2, Ac-MIF1, or Ac-MIF2-NH2 for 3
    days. Giemsa staining was performed and fusion indices had been decided as we beforehand described [52].
    C2C12 cells had been grown in growth medium till 70% confluent, after which in myogenic differentiation medium (DMEM + 2% FBS +
    1% P/S) supplemented with MIF1, MIF2, Ac-MIF1 and Ac-MIF2-NH2 for 3 days
    to advertise myoblast differentiation. Scratch assays are often used to check cell migration parameters similar
    to velocity, persistence, and polarity [31].

    Myostatin is produced by the muscle tissue of the guts, and harm
    to the center causes it to be released into the bloodstream.
    Once within the bloodstream, myostatin reaches the muscles and causes them to weaken over time.
    As a result, patients with heart illness usually also experience signs of muscle atrophy (muscle
    loss) [10]. Physical train, notably weightlifting, can naturally lower myostatin exercise.
    Studies show that resistance coaching improves muscle fibers, reduces body fat, and stimulates skeletal muscle hypertrophy.
    Myostatin inhibitors block or decrease myostatin exercise and “unlock” your muscle-building potential.
    By suppressing myostatin expression or its signaling pathways, these inhibitors enable
    your body to create extra muscle fibers and reduce muscle atrophy.

    References:

    benefits Of using steroids

Để lại một bình luận

Email của bạn sẽ không được hiển thị công khai. Các trường bắt buộc được đánh dấu *